Twitter Updates

    follow me on Twitter

    Monday, May 4, 2009

    Wine Adds Five Years to Life, More Than Beer, Dutch Study Finds

    Half a glass of wine a day may add five years to your life, a new study suggests. Drink beer, and you’ll live only 2 1/2 years longer.

    Dutch researchers followed 1,373 men for more than four decades, noting their eating and drinking habits. Men who had about 20 grams of alcohol daily -- equivalent to a half a glass of wine -- had 2 1/2 years added to their life expectancy at age 50, compared with men who didn’t drink at all, according to the research published today in the Journal of Epidemiology and Community Health. Men who consumed only wine had twice as much added longevity.

    Light alcohol intake was linked to lower cardiovascular, cerebrovascular and overall mortality in the study. Researchers had known that moderate drinking is tied to a lower risk of heart disease, possibly because of an increase in high density lipoprotein or so-called good cholesterol as well as a reduction in platelet clumping, making it more unlikely for clots to form. It is the first study to show that one kind of alcohol is superior to others in prolonging life, the researchers said.

    “In this study, 70 percent of all wine consumed was red wine,” the researchers, led by Marinette Streppel of the University of Wageningen in the Netherlands, said in the paper. “This suggests that the cardioprotective effect of wine could be due to a protective effect of polyphenol compounds in red wine, but other explanations cannot be ruled out.”

    Polyphenols are chemical substances found in plants such as tannins and flavonoids.

    The research, dubbed Zutphen Study after the Dutch town from which the participants were recruited, followed men born between 1900 and 1920 and examined them several times between 1960 and 2000.

    Source: Bloomberg.com

    Drink A Little Wine, Live A Little Longer

    Men who regularly drank up to a half a glass of wine each day boosted their life expectancy by five years, Dutch researchers report.

    Light, long-term alcohol consumption of all types of beverages, whether wine, spirits or beer, increased life by 2.5 years among men compared with abstention, the researchers found. By "light," they meant up to 20 grams, or about 0.7 ounces a day.

    While numerous other studies have found similar benefits, study author Martinette Streppel, of the division of human nutrition at Wageningen University in the Netherlands, said 40 years of follow-up is noteworthy for many reasons.

    "The main strength of our study was the collection of detailed information on the consumption of different alcohol beverages at each of seven measurement rounds," Streppel said.

    The long-term, regular follow-up, Streppel added, enabled the researchers to study the effect of long-term alcohol intake on mortality.

    The study is published online in April in the Journal of Epidemiology and Community Health.

    The Dutch researchers evaluated 1,373 men, all part of the Zutphen Study, started in 1960 and named for an industrial town in the Netherlands. The researchers followed them from 1960 to 2000, tracking weight, diet, cigarette smoking, the diagnosis of serious illness and other data, along with their drinking habits.

    Over the follow-up period, 1,130 of the men died, half from cardiovascular disease.

    The proportion of men who drank alcohol nearly doubled from 45 percent of the men in 1960 to 86 percent in 2000. Those drinking wine rose even more dramatically -- from just 2 percent to 44 percent.

    The findings in more detail:

    • All long-term light alcohol drinking boosted life expectancy by about 2.5 years in comparison to abstainers. Drinking more than 0.7 ounces a day extended life expectancy by nearly two years compared with nondrinkers.
    • Wine drinkers who averaged just 0.7 ounces a day had a 2.5 year-longer life expectancy at age 50 compared to those who drank beer or spirits. And their life expectancy was nearly five years longer than nondrinkers.
    • Drinking moderately was linked with lower death risk, and drinking wine was strongly linked with a lower risk of dying from heart disease, stroke or other causes.
    Streppel couldn't say if the findings apply to women, but suspects the polyphenolic compounds found in wine, especially red wine, produce the heart-healthy effects.

    The study adds to the literature of the health benefits of alcohol, but has both strengths and weaknesses, said Dr. Arthur Klatsky, a long-time investigator on the health benefits of alcohol.

    "Once again, it shows that people who drink [moderately] do a lot better than people who don't in terms of survival," he said.

    However, as with other research, Klatsky wondered if it's the pattern of drinking or something related to the wine drinking -- such as wine drinkers being more likely to exercise or eat a healthy diet -- that is the real link.

    In the new Dutch study, he says, alcohol from spirits contributes the most to the total alcohol intake, more than wine or beer.

    "It's a little hard to think that a little bit of wine is what is responsible for extending their life," Klatsky said.

    The finding, like similar ones, applies more to middle-aged people than younger ones, he said. "People over 50 are the ones most likely to have health benefits from light drinking anyways."

    Much more important in reducing heart disease risk, he said, is not smoking, exercising regularly, eating healthfully and maintaining a healthy weight.

    Source: KVIA.com

    Monday, April 27, 2009

    Wine Chemicals Show Cancer-Fighting Potential

    While scientists continue to explore the relationship between alcohol and breast cancer, and what role consumption patterns may play, two recent scientific studies offer a brighter picture for red wine drinkers, though the authors are cautious about making specific recommendations on safe wine consumption. Both find that polyphenolic chemicals in wine appear to fight cancer cells in the lab. But questions remain on what impact they might have in the body.

    The first study comes from the University of Puerto Rico and was published in the March issue of Clinical & Experimental Metastasis. The research notes that red wine's potential for preventing cancer is attributed to the beverage's high polyphenol content. These plant-based antioxidants are found abundantly in the skins and seeds of grapes and leech into the wine during fermentation, giving red wine potentially greater health benefits.

    When the scientists exposed human breast cancer cells in the lab to a combination of three polyphenols commonly found in red wine—resveratrol, quercetin and cathechin—they found that the rate of cell death was 40 percent to 55 percent greater than when the cells were left alone. After 77 days, breast cancer tumors treated with the polyphenols were 30 percent to 50 percent smaller than the control tumors.

    Furthermore, the polyphenol cocktail appeared to reduce metastasis in bone, kidney and liver cancer lines by an average of roughly 60 percent. Lung and lymphatic cancer lines were unaffected by the treatment. The results echo the university's earlier research, published in the March 2008 issue of Translational Oncology, that such a combination may help inhibit the progression of breast cancer in mice.

    Surangani Dharmawardhane Flanagan, chief of the cell biology section at the university's school of medicine, worked on both of the studies. "We gave the red wine compounds to the mice in 10 percent ethanol, which is close to the amount of alcohol in wine," Flanagan said. "It shows that wine should protect against bone and liver metastases."

    Flanagan hesitated to formally recommend drinking wine because of the dangers of alcohol, but noted that she would be "comfortable with a qualified statement saying that red wine can protect against breast cancer metastasis," since "the antioxidants in red wine can also reduce the oxidant effects of alcohol that can cause cancer, and therefore drinking wine may be more protective than drinking other types of alcohol."

    A recent study in Sweden did not look directly at breast cancer, but did look at ways of stopping the spread of cancers. Conducted at the Karolinska Institute's department of neuroscience and slated to appear in the journal Experimental Cell Research, the study found that the red wine antioxidant resveratrol can kill cancer cells in a previously unobserved manner.

    Researcher Ola Hermanson, who works in the institute's department of developmental biology for regenerative medicine, gave Wine Spectator a sneak peek at the findings. "When we apply very small amounts, a few microliters, of red wine directly on drug-resistant cancer cells in a petri dish, the cells die basically immediately. This death is associated with increased oxygen levels, alas, the opposite of what we expected."

    "It turns out that there is something in the red pigment of the wine that inhibits a specific enzyme, thioredoxin reductase (TrxR), in the cancer cells," said Hermanson. "TrxR is a major guardian of proper oxygen levels in the cells. When inhibited, the oxidative stress and the so-called 'oxygen species' increase and the cells die."

    This inhibition of TrxR correlates perfectly with the intensity of the red wine's color. Shiraz and Syrah had very strong effects, while brighter wines had less effect and white wine had no effect on the cancer cells.

    But the effects may not be the same inside the body since the wine must be metabolized and passed though the liver first. "We do not know at this stage how it would affect the anti-cancer properties of the red wine," said Hermonson. "Further, even if the amounts of wine given to the cells are very small, it still corresponds to very large amounts if consumed—roughly several bottles at a very quick pace."

    Source: WineSpectator.com

    Friday, April 24, 2009

    Resveratrol May Slow Drinking-Linked Liver Condition

    The accumulation of fat in the liver caused by chronic alcohol consumption might be prevented by consuming the red wine ingredient resveratrol, a new study in mice suggests.

    Reducing fat in the liver can help stave off liver diseases such as cirrhosis and fibrosis, researchers note.

    Previous studies have suggested that resveratrol -- a substance found in grapes, peanuts, berries and red wine -- may have anti-cancer and anti-inflammatory properties, as well as cardiovascular benefits. However, these findings have not been conclusive in humans.

    The study, by researchers at the University of South Florida Health Sciences Center in Tampa, concluded that resveratrol cut down on the amount of fat produced in the livers of mice given alcohol and, simultaneously, increased the breakdown of fat in the liver.

    The research was published in the American Journal of Physiology -- Gastrointestinal and Liver Physiology.

    The study adds to previous research that suggested alcohol shuts off two molecules -- AMP-activated protein kinase (AMPK) and sirtuin 1 (SIRT1) -- that are key to initiating the breakdown of fats in the liver. Resveratrol, however, appears to do the opposite, switching on the molecules and helping to clear out fat. This stops fat from accumulating in the mouse liver by both reducing the production of fat and burning off the fat that is there.

    Surprisingly, alcohol with resveratrol appears to enhance the positive effects of resveratrol alone, according to study senior author Min You.

    "Our study suggests that resveratrol may serve as a promising agent for preventing or treating human alcoholic fatty liver disease," the authors concluded.

    Source: KRDO.com

    Wednesday, April 22, 2009

    Wine May Guard Against Lymphoma Recurrence

    Patients with non-Hodgkin lymphoma who drank wine before their diagnosis appeared to have a reduced risk of relapse or death, according to a study that's the first to identify this connection.

    The researchers looked at more than 500 women with non-Hodgkin lymphoma and found that, overall, those who drank wine before their diagnosis had a 76 percent five-year survival rate, compared with 68 percent for those who didn't drink wine. The five-year, disease-free survival rate was 70 percent for wine drinkers and 65 percent for non-wine drinkers.

    Further analysis by the Yale School of Public Health team revealed that patients who drank wine for at least 25 years before their diagnosis had a 25 percent to 35 percent reduced risk of relapse, secondary cancer or death.

    The strongest link between wine consumption and improved outcomes was among patients with diffuse large B-cell lymphoma. Overall, they had a 40 percent to 50 percent reduced risk of relapse, secondary cancer or death, while those who drank wine for 25 years or more had about a 60 percent reduced risk.

    Drinking beer or liquor had no beneficial effect, according to the researchers, who were to present the findings Tuesday at the American Association for Cancer Research (AACR) annual meeting, in Denver.

    The findings need to be replicated before any public health recommendations are made, but the study offers further evidence that moderate consumption of wine has health benefits, wrote first author and doctoral candidate Xuesong Han.

    "This conclusion is controversial, because excessive drinking has a negative social and health impact, and it is difficult to define what is moderate and what is excessive. However, we are continually seeing a link between wine and positive outcomes in many cancers," Han said in an AACR news release.

    Surce: KVBC.com

    Monday, April 20, 2009

    SIRT1 Acts as a Nutrient-Sensitive Growth Suppressor and Its Loss Is Associated with Increased AMPK and Telomerase Activity

    ABSTRACT

    SIRT1, the mammalian homolog of SIR2 in Saccharomyces cerevisiae, is an NAD-dependent deacetylase implicated in regulation of lifespan. By designing effective short hairpin RNAs and a silent shRNA-resistant mutant SIRT1 in a genetically defined system, we show that efficient inhibition of SIRT1 in telomerase-immortalized human cells enhanced cell growth under normal and nutrient limiting conditions. Hematopoietic stem cells obtained from SIRT1-deficient mice also showed increased growth capacity and decreased dependency on growth factors. Consistent with this, SIRT1 inhibition was associated with increased telomerase activity in human cells. We also observed a significant increase in AMPK levels up on SIRT1 inhibition under glucose limiting conditions. Although SIRT1 suppression cooperated with hTERT to promote cell growth, either overexpression or suppression of SIRT1 alone had no effect on life span of human diploid fibroblasts. Our findings challenge certain models and connect nutrient sensing enzymes to the immortalization process. Furthermore, they show that in certain cell lineages, SIRT1 can act as a growth suppressor gene.

    INTRODUCTION

    Loss of silencing of mating type loci in Saccharomyces cerevisiae (Hopper and Hall, 1975 ; Haber and George, 1979 ) led to discovery of a gene named MAR1 (mating-type regulator 1; Klar et al., 1979 ) also known as SIR2 (silent information regulator 2; Rine et al., 1979 ). Increased dosage of SIR2 extends replicative lifespan in certain strains of S. cerevisiae (Kaeberlein et al., 1999 ) and increases longevity of Caenorhabditis elegans (Tissenbaum and Guarente, 2001 ). Studies also have shown that CR (calorie restriction) may mediate lifespan extension through SIR2 (Lin et al., 2000 ) or HST2 (Lamming et al., 2005 ). However, newer studies have challenged these notions and shown that CR-dependent replicative lifespan extension occurs in a SIR2/HST2-independent manner (Kaeberlein et al., 2004 ; 2006 ).

    In the case of chronological lifespan in yeast, SIR2 mediates the opposite effect (limiting lifespan). In one study, deletion of SIR2 promoted chronological lifespan extension under CR (Fabrizio et al., 2005 ). Early studies on SIR2 of S. cerevisiae suggested that SIR2 has an ADP-ribosylating activity in vitro (Moazed, 2001 ). This subsequently led to uncovering an activity capable of deacetylating synthetic acetylated histone substrates in vitro (Imai et al., 2000 ), generating O-acetyl ADP-ribose (Tanner et al., 2000 ; Tanny and Moazed, 2001 ). The in vivo deacetylation targets of mammalian SIR2 homolog (SIRT1) are nuclear factors such as p53 (Luo et al., 2001 ; Vaziri et al., 2001 , Langley et al., 2002 , Michishita et al., 2005 ), FOXO (Brunet et al., 2004 ; Nemoto et al., 2004 ), Ku (Cohen et al., 2004a ), acetylated histones (Vaquero et al., 2004 ), and nuclear factor (NF)-κB (Yeung et al., 2004 ).

    More recently novel activators of SIRT1 such as HIC1 and AROS have also been identified that activate SIRT1 and promote deacetylation of its targets such as p53 (Chen et al., 2005 ; Kim et al., 2007 ). SIRT1 is also suggested to act as a nutrient sensor in response to caloric restriction (Cohen et al., 2004b ; Nemoto et al., 2004 ). In S. cerevisiae, Sir proteins have been shown to have critical roles in response to DNA damage and are mobilized from telomeres to sites of DNA strand breaks (McAinsh et al., 1999 ; Mills et al., 1999 ) and are involved in maintenance of telomeric silencing (Moretti et al., 1994 ). Synthesis of de novo telomere repeats is achieved by telomerase an enzyme originally detected as an RNP (ribosenucleotide protein) complex in Tetrahymena (Greider and Blackburn, 1985 ) and subsequently in human cells (Morin, 1989 ). The mammalian telomerase is composed of a reverse transcriptase catalytic subunit (hTERT; Harrington et al., 1997 ; Meyerson et al., 1997 ; Nakamura et al., 1997 ) and an RNA template (hTR; Feng et al., 1995 ). Inactivation of telomerase in Mus musculus has revealed roles in cell survival and maintenance of genomic integrity via telomere maintenance (Blasco et al., 1997 ; Lee et al., 1998 ). Telomere maintenance and regulation in mammals is achieved by collaborative effects of telomerase and telomere-binding proteins (van Steensel and de Lange, 1997 ). Protective effects of telomeres on chromosome ends may be achieved via function of specialized protein complexes including TRF1/TRF2/TIN2 (Smogorzewska and de Lange, 2004 ) and other single-strand G-rich telomere-binding proteins such as Pot1 that regulate accessibility of telomeres to telomerase (Baumann and Cech, 2001 ; Colgin et al., 2003 ). Human diploid fibroblasts have a finite lifespan and undergo senescence upon completion of a fixed number of cell doublings (Hayflick and Moorhead, 1961 ). At least a part of this molecular clock is thought to operate through telomere erosion or dysfunction with each division in normal cells that ultimately triggers initiation of cellular senescence (Harley et al., 1990 ). Consistent with this model telomerase is reactivated in immortal human cells (Counter et al., 1992 ; Kim et al., 1994 ).

    Further direct findings indicate that reconstitution of telomerase activity in vivo in primary mortal human fibroblasts causes bypass of senescence and leads to cell immortality (Bodnar et al., 1998 ; Vaziri and Benchimol, 1998 ). Consistent with this model, human germ cells maintain their telomeres (Allsopp et al., 1992 ), and human embryonic and adult hematopoietic stem cells express telomerase (Chiu et al., 1996 ). This telomerase activity in hematopoietic stem cells is not sufficient to prevent telomere shortening and may confer a finite self-renewing capacity (Vaziri et al., 1994 ). Telomerase has since been widely used as a marker for identification of human pluripotent stem cells (Shamblott et al., 2001 ).

    Here we investigate the role of SIRT1 in regulation of replicative life span and cell growth in primary, telomerase-immortalized human cells and murine hematopoietic stem cells under normal and nutrient-limiting conditions. We designed effective short hairpin RNA (shRNA) constructs that are able to reduce SIRT1 protein expression significantly. By suppressing endogenous SIRT1 in human cells we show that SIRT1 can negatively regulate cell growth, and this is associated with an increase in telomerase activity levels. Extension of these findings to an animal model indicates that hematopoietic stem cells from mice lacking SIRT1 show a greater proliferative capacity under conditions of stress. We propose that SIRT1 is a nutrient-sensitive growth suppressor in certain cell types. Therefore our findings have implications for growth of normal and immortal cells.

    MATERIALS AND METHODS

    Cell Culture and Cell Lines

    All cell strains were grown either in DMEM + 10% fetal bovine serum (FBS) in 60–100-mm Petri dishes (Greiner, Frickenhausen, Germany). A rapid plasmid-based system (Vaziri et al., 2001 ) was used to generate all retroviruses (Imgenex, San Diego, CA). In brief, pSRP (pSUPER-Retro-Puro), pSRP-shSIRT1(HS6), pSRP-shSIRT1(HS11) and pSRP-shControl, pBabe-Ires-Neo, pBabe-Ires-Neo-SIRT1-R, and pBabe-puro-wtSIRT1 vectors and packaging plasmid (Imgenex) were transfected into 293T cells using Fugene 6, and supernatants were used to infect the target cells carrying mCAT1. Cells were typically infected with pSRP-based viruses at multiplicity of infection (MOI) of ≈20, two times sequentially and subsequently selected in 1 μg/ml puromycin or 200–400 μg of G418. Wild-type or SIRT1-R viruses were put in at ≈2–5 MOI.

    Cell Culture in Absence of Nutrients

    Initially, cells were grown in growth medium (H21 medium, Invitrogen, Carlsbad, CA; cat no 12800) with 10% FBS (Invitrogen) under low density in 60-mm dishes. Twenty-four hours later, the exponentially dividing cells were washed once with phosphate-buffered saline (PBS; −Ca and −Mg). Media on the cells was subsequently changed with 4 ml of α-MEM without glucose and serum (89-5118EF, Invitrogen, with base media to which aspargine, arginine, methionine, isoleucine, l-valine, and ascorbic acid with antibiotics were added; OCI, Toronto, Ontario, Canada, Media Department). Duplicate dishes were used to estimate the total number of cells in the plates. For each cell line the cells were trypsinized, neutralized by addition of α-MEM without glucose with 2% FBS, and counted on a hemocytometer using trypan blue exclusion. The average live cell count was then calculated. Cell counts were performed every 24 h after the addition of the α-MEM without glucose. Cells were collected at different time points (0, 4, 8, 12, and 15 h) after addition of α-MEM without glucose and subjected to lysis as described below under immunoblotting.

    Telomerase Assays

    TRAP (telomere repeat amplification protocol) assays were performed as previously described (Kim and Wu, 1997 ). Typically, within 2–10 population doublings (PDs) after selection, CHAPS lysates were prepared from cells, and aliquots were frozen. For rescue experiments cells from ≈PD 93 were used to prepare lysates. On thawing, the lysates were subjected to protein quantification using the quick-start Bradford assay system (Bio-Rad, Hercules, CA). Twenty-six–cycle PCR-TRAPs were performed in linear range of the assay using 50–300 ng of total protein lysate per reaction. TRAP products were resolved on 15% polyacrylamide large gels and exposed to phosphorimager screens.

    Design of SIRT1 shRNA Expression Vectors, shRNA-resistant Silent Mutant

    More than 12 shRNAs were designed to find the most effective set. The most effective we developed was HS6 (Qiagen, Chatsworth, CA). The second sequence (HS11) was based on a published sequence (Ota et al., 2006 ).

    The SIRT1 shRNA sequences (bold) used as insert in pSRP (pSuper-Retro-Puro, OligoEngine, Seattle, WA) vector were as follows: HS6:

    GATCCCCAGCGATGTTTGATATTGAATTCAAGAGATTCAATATCAAACATCGCTTTTTTA. HS11: GATCCCCGATGAAGTTGACCTCCTCATTCAAGAGATGAGGAGGTCAACTTCATCTTTTTA. The control shRNA sequence was as follows: GATCCCCTTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGAGAATTTTTA.

    A PCR-based strategy was used to introduce six silent mutations in the SIRT1 region targeted by the HS6 shRNA (for sequence, see Supplementary Figure 1A). The resulting mutant named SIRT1-R was subcloned in the PBabe-INeo vector. This vector PBIN-SIRT1-R and the backbone (PBIN) were subsequently used to infect puromycin-resistant target cells expressing pSRPshControl and pSRPshSIRT1(HS6) for a genetic rescue experiment.

    Immunoblotting

    Cells were harvested by trypsinization (0.05%) and neutralized with either DMEM + 10% FBS (for nutrient experiments, MEM without glucose + 2% FBS). Cells were spun and washed in PBS−/− twice, and the pellets were lysed in 0.5% NP40, 150 mM NaCl, and 50 mM Tris in presence of 1× complete miniprotease inhibitor mix (Roche, Indianapolis, IN; 10× stock, 1 tablet in 10 ml water), for 30 min with occasional vortexing. Cell lysates were centrifuged at 12,000 rpm for 20 min at 4°C. Protein content of lysates was measured by Bio-Rad Quick Start protein assay (500–0201). Protein, 10–50 μg, was resolved on NuPAGE (Novex, Encinitas, CA) 4–12% Bis-Tris gradient gels, transferred to PVDF membranes (Bio-Rad) and blocked in 5% skim milk. The membrane was incubated in: 1:5000 dilution for anti-SIRT1 (Vaziri et al., 2001 ), 1:500 for 2 h for hTERT (Santa Cruz Biotechnology, Santa Cruz, CA; H-231: SC-7212), 1:20,000 for β-actin (Abcam, Cambridge, MA) 10–20 min, 1:2000 dilution of Phospho-AMPK-α (Thr172)(40H9) and total AMPK-α (23A3) (Cell Signalling, Beverly, MA; kit 9957) for 2 h. For AMPK experiments membranes were first immunoblotted with total anti-AMPK-α antibody, and the levels were measured. To prevent residual carry over, the membrane was subsequently stripped and after testing for clearance was subjected to the phospho-AMPK-α antibody for detection of active form.

    The membrane was washed twice in 0.05% TBST buffer for 20 min. Peroxidase conjugated AffinPure goat anti-rabbit horseradish peroxidase IgG (H+L) secondary antibody or anti-mouse (Jackson ImmunoResearch, West Grove, PA) were used at a concentration of 1:30,000 for 45 min in 1% milk was used. After washing, the membrane was then incubated with Super signal west, dura, or femto maximum substrate (Pierce, Rockford, IL) for 2 min and exposed to film for up to 30 min.

    Chromatin Immunoprecipitation

    Cells (107) were cross-linked in plates by addition of 1% formaldehyde for 10 min, followed by the addition of glycine to a final concentration of 0.125 M to stop the cross-linking reaction. Hela-pSRP-controlshRNA and Hela-pSRPshSIRT1 cells (n = 107) were used per immunoprecipitation reaction mixture. Cells were washed twice in PBS and lysed in 1 ml of cell lysis buffer (5 mM PIPES, pH 8.0, 85 mM KCl, 0.5% NP-40, 1× protease inhibitors) on ice for 10 min. The nuclei were pelleted at 5000 rpm and lysed in nuclei lysis buffer (50 mM Tris, pH 8.1, 10 mM EDTA, and 1% SDS, including protease inhibitors on ice for 10 min. The chromatin was sonicated eight times, 15 s each on ice. The samples were precleared by incubating with 20 μl of blocked protein G agarose beads (Roche) containing 1.5 μg of sea urchin sonicated sperm DNA for 15 min. The protein-chromatin complexes were incubated with no antibody, 3 μl of antiacetylated histone H4 antibody (06-866; Upstate Biotechnology, Lake Placid, NY), anti-SIR2 antibody (2 μl), or rabbit serum (2 μl) at 4°C overnight. Each reaction mixture was then incubated with 20 μl of protein G beads for 30 min at room temperature. The protein G agarose beads were pelleted, and the supernatant from the no-antibody sample was used as total input chromatin (input). The protein G agarose pellets were washed twice in dialysis buffer (2 mM EDTA, 50 mM Tris, pH 8.0) and four times in immunoprecipitation (IP) wash buffer (100 mM Tris, pH 9.0, 500 mM LiCl, 1% NP-40, 1% deoxycholic acid). The protein-chromatin complexes were eluted from the protein G agarose beads twice in IP elution buffer (50 mM NaHCO3, 1% SDS), followed by reverse cross-linking in 0.3 M NaCl along with 1 μg of RNase-A at 67°C for 5 h. The reactions were precipitated with 2.5 volumes of ethanol at −20°C overnight. The reaction mixtures were then centrifuged at 13,200 rpm for 20 min, and the pellets were air-dried and resuspended in 100 μl of Tris-EDTA–proteinase K buffer (final reaction concentrations, 10 mM Tris, pH 7.5, 5 mM EDTA, 0.25% SDS, and proteinase K (1 U) and incubated at 45°C for 2 h. Subsequently, the samples were purified by phenol-chloroform extraction. NaCl (final concentration of 0.14 M), and 2.5 volumes of ethanol were then added, and the samples were allowed to precipitate overnight at −20°C. The samples were centrifuged at 13,200 rpm for 20 min, and the pellets were air dried and resuspended in 50 μl of water. Two microliters of the purified DNA was used for each PCR. In addition the input DNA was diluted 1:20, and the same volume was used in the PCR reaction. The PCR was performed with the following primers: Forward : 5′-acgtggcggagggactg, and Reverse: 5′-gccagggcttcccacgt.

    PCR conditions were as follows: 94°C for 3 min, followed by 32 cycles at; 94°C for 0.45 min; 65°C for 0.30 min; and 72°C for 0.30 min. The ChIP (chromatin immunoprecipitation) PCR products were analyzed on a 2% agarose gel and analyzed using the Bio-Rad imaging system.

    Population Doubling Assays

    Primary BJ cells infected with pSRPshControl and pSRPshSIRT1(HS6) were grown in DMEM + 10% FBS and were subjected to a standard replicative lifespan assay. Late passage BJ fibroblasts strain ~7 PDs away from senescence was infected with pM-hTERT-IRES-EGFP vector (MSCV-based vector, Weinberg lab). Immediately after green fluorescent protein (GFP) was expressed these BJT cells were either infected with pSRP, pSRP-shControl, or pSRP-shSIRT1(HS6) viruses. After selection in 1 μg of puromycin for 4 d, the resistant cells were split and grown for a standard population-doubling analysis.

    RT-PCR Analysis

    For RT-PCR analysis, Trizol reagent was used to purify total RNA from cells. First-strand cDNA synthesis was performed as described by manufacturer (Amersham Biosciences, Piscataway, NJ). The sequence of primers used is described elsewhere (Nakamura et al., 1997 ). The resulting cDNA were quantified on a Turner fluorometer, and equal DNA amounts were used for the PCR amplification. PCR amplification was performed using 25 cycles in presence of a 32P-labeled forward hTERT primer. Products were resolved on 15% polyacrylamide gels and exposed to phosphoimager screens, and bands were quantified using Image Quant (Molecular Dynamics, Sunnyvale, CA/Amersham). hTERT signals were normalized to the GAPDH signal. Quantitative-PCR on an ABI 7900HT sequence detection system (Applied Biosystems, Foster City, CA) with SYBR Green chemistry (Qiagen). The cDNA preparation was similar to that of RT-PCR use; however, the template was used at a final concentration of 500 ng/reaction in a 20 μl total reaction volume. Each sample had been run through the Q-PCR (quantitative PCR) analysis in triplicate on freshly synthesized cDNA, using a no-template negative control for each sample set of cDNA and primers. Each 20-μl reaction contained 10 μl of SYBR Green master mix, 2 μl of template cDNA or water, 1 μl of forward and reverse primer mix at 0.6 μM each/reaction, and 7 μl of nuclease-free water.

    Hematopoietic Stem Cell Analysis and Culture

    The Sirt1 knockout strain (from Dr. Fred Alt, Harvard Medical School) was back-crossed five times onto a C57BL6 background before performing this study. In all experiments, young mice (3–9 wk old) were used. Mice were fed with a standard diet and maintained in a temperature- and light-controlled room (228C, 14L:10D; light starting at 0700 h), in accordance with the guidelines of the Laboratory Animal Services at the University of Hawaii and the Committee on Care and Use of Laboratory Animals of the Institute of Laboratory Resources National Research Council (DHEW publication 80-23, revised in 1985). The protocol for animal handling and treatment procedures was reviewed and approved by the Animal Care and Use Committee at the University of Hawaii. Hematopoietic stem cells (HSCs) were analyzed using flow cytometry as previously described (Allsopp et al., 2002 ; Rossi et al., 2005 ; Yilmaz et al., 2006 ). Briefly, whole bone marrow (WBM) was flushed from the tibia and femur bones, and cells were stained with antibodies to c-Kit, Sca-1, plus a lineage cocktail, as well as either antibodies to Flk2 and CD34, or CD150 (SLAM). All analysis and cell sorting was performed on a FACS Aria (Becton-Dickinson). For HSC culture, complete media consisted of X-Vivo 15 media (BioWhittaker, Walkersville, MD) plus 5 × 10−5 M 2-mercaptoethanol, Steel factor (10 ng/ml), IL-3 (30 ng/ml), IL-6 (10 ng/ml), IL-11 (10 ng/ml), Tpo (10 ng/ml), and Flt3 ligand (10 ng/ml). Cells were cultured in standard tissue culture incubators at 5% CO2.

    RESULTS

    Inhibition of SIRT1 and Telomerase Activity

    Low hTERT-expressing primary human BJT diploid fibroblasts, Hela cells, and Lovo cells were infected with pSRP-shSIRT1(HS6), pSRP-ShSIRT1(HS11), and pSRP-shControl (a control shRNA). Cells were selected in puromycin and kept under selection for the remainder of experiments. SIRT1 expression was effectively reduced to varying degrees in all cell types by shSIRT1 (Figure 1, A–D). The HS6 shRNA was more effective than HS11 (Figure 1D). In all cell lines in which SIRT1 shRNA was stably expressed, we observed an increase in telomerase activity as measured by TRAP (Figure 1, E–G). As an additional control we ran the TRAP reaction in the presence of an internal control for which similar results was observed (Figure 1H). Furthermore, in order to rule out the possibility of off-target effects, we took two strategies. First, we used a second shRNA (HS11) for SIRT1 suppression (Figure 1, D and I), and most importantly we designed a shRNA-resistant SIRT1 gene, (SIRT1-R) in which we introduced six silent mutations in the region targeted by HS6. Expression of this shRNA-resistant mutant (Supplementary Figure 1B) of SIRT1 in BJT cells blocked the ability of shSIRT1(HS6) to induce telomerase activity (Figure 1J). It is noteworthy to mention that we found that higher than physiological quantities of wild-type SIRT1 or a SIRT1H363Y mutant can lead to enhancement or suppression of telomerase activity, respectively (Supplementary Figure 1C). Hence by using two independent shRNAs and a genetic rescue experiment we show that SIRT1 suppression is associated with an increase in telomerase activity and is not due to off-target effects.


    Figure 1
    Effect of SIRT1 suppression on telomerase activity in human cells. (A) Suppression of SIRT1 in BJ-hTERT cells (BJT). BJT cells were infected with a control shRNA expressing retrovirus pSRP-shControl or SIRT1 knockdown virus pSRP-shSIRT1(HS6). Cell lysates were subjected to immunoblotting using an anti-SIRT1 antibody or a β-actin antibody. (B) Suppression of SIRT1 in Lovo cells. The same retroviral vectors as in A and in analysis were used. (C) Suppression of SIRT1 in Hela cells. The same retroviral constructs as in A were used. (D) Suppression of SIRT1 in Hela cells using control shRNA retrovirus and two shSIRT1 (HS6) and shSIRT1 (HS11) constructs.(E) Parental BJ cells expressing ectopic pM (MSCV)-hTERT-IEGFP were infected with pSRP-shControl RNA or pSRP-shSIRT1 (HS6) virus. Within 6 PDs after selection in puromycin, cells were lysed in CHAPS lysis buffer, and equal protein quantities (50 and 300 ng) were subjected to TRAP analysis to determine telomerase activity. Control RNase and heat treatments all contained 300 ng of protein lysate. (F) Lovo cells were infected twice with the viruses and were subjected to TRAP analysis. Protein amounts of 50, 200, and 600 ng were used in the TRAP reaction. (G) Same as F except Hela cells were used. (H) Same as in G except internal controls were included using HeLa cell extracts (10, 50, and 200 ng). (I) A second shRNA (HS11) was used to suppress SIRT1 in Hela cells and TRAP analysis was performed as in H. (J) Same cells as in A (BJ-hTERT-IEGFP with and without shRNA against SIRT1) were infected with pBabe-neo (PBN) control vector or with an shRNA-resistant silent SIRT1-R expressing construct (PBN-SIRT1-R) generating four additional lines. Two protein concentrations (50 and 200 ng) from four cell line were subjected (total of 16) to the TRAP analysis. The first six lanes are experimental controls. Lanes 7 and 8 are results of rescue experiments. The last three lanes are negative controls for the TRAP reaction.


    SIRT1 Suppression and hTERT

    To determine the mechanism through which SIRT1 suppresses hTERT activity, we performed RT-PCR and immunoblotting in shSIRT1-expressing cells. When SIRT1 was suppressed in Hela cells, an ≈3-fold increase in the level of hTERT protein was observed (Figure 2A), and this was accompanied by a 0.3-fold increase in the levels of hTERT mRNA both by in-gel RT-PCR (Figure 2B) and an insignificant but reproducible increase of 0.3–0.5-fold by real-time quantitative PCR (Figure 2, C and E). We conclude that SIRT1 controls endogenous and exogenous hTERT expression possibly at the level of RNA stability and/or through changes in chromatin structure at the hTERT promoter. To test this model, we performed ChIP experiments 240 nucleotides upstream of ATG in the hTERT promoter (Figure 2F). We used a pan-acetyl antibody against acetylated histone H4 and found that Hela cells in which SIRT1 was suppressed contained more total acetylated H4 on hTERT promoter than control cells expressing endogenous SIRT1. Furthermore, a small amount of SIRT1 was associated with hTERT promoter (Figure 2F) in control cells but not in SIRT1 knockdown cells. These results indicate that there is a transcriptional component (albeit small) to the observed effect. When we performed effective knockdown of SIRT1 in BJ-hTERT cells, we found that compared with controls, the BJ-hTERT-pSRP-SIRT1 cells showed a slower migrating band (Figure 2D). Although this suggests a posttranslational component by acetylation in stabilization of hTERT, further experimentation is required to show that the effect is directly through posttranslational modification of hTERT.


    Figure 2
    Regulation of hTERT. (A) Effect of SIRT1 suppression on hTERT protein in Hela cells. Western blot analysis was performed on cell lysates, and they were subjected to immunoblotting with anti-SIRT1, anti-hTERT, and anti-β-actin antibodies. (B) Effect of SIRT1 suppression on hTERT mRNA in Hela cells. Total RNA was isolated from Hela-pSRP-shControl and Hela-pSRPshSIRT1 cells and hTERT mRNA was quantified by quantitative radioactive in-gel PCR as described (Nakamura et al., 1997 ). The ratio of hTERT/GAPDH is shown. (C) Quantification of hTERT mRNA in Hela and Hela-pSRPshSIRT1 cells by real-time Q-PCR. The values shown are normalized to an internal GAPDH control. (D) Regulation of hTERT protein in BJT cells. BJT-pSRP-shControl and BJT-pSRPshSIRT1 cell lysates were resolved on 4–12% gradient gels, and immunoblotting was performed using an anti-hTERT rabbit antibody. Primary BJ cells in the first lane were used as negative control. (E) Effect of SIRT1 suppression on hTERT mRNA in BJT cells. Same as in C except that BJT and BJT-pSRPshSIRT1 cells were used. (F) ChIP of hTERT promoter using the antibodies shown. Hela control and SIRT1(HS6) knockdown cells were used in each ChIP reaction as shown. Antibodies used were against total acetylated H4 and SIRT1. Controls were rabbit serum (RS) and no antibody reactions. For details consult Materials and Methods.


    SIRT1 Inhibition Cooperates with hTERT to Promote Cell Growth under Normal and Low Nutrient Conditions

    Having shown that SIRT1 suppression is associated with increased telomerase activity, we wanted to determine if SIRT1 and telomerase functionally cooperate in a replicative lifespan assay in human cells. The shRNA-mediated repression of SIRT1 in primary BJ fibroblasts did not affect replicative lifespan in a long-term assay (Figure 3A). Furthermore, no significant effect on replicative lifespan was observed when SIRT1 was overexpressed (Figure 3B). Next, we asked if SIRT1 repression affected the growth of ectopic hTERT-expressing BJ cells. We first introduced hTERT in the same primary BJ cells, and then subjected these telomerase-positive cells to infection with the shSIRT1(HS6), control shRNA virus, or the backbone virus (pSRP). We observed that the population doubling time of cells expressing shSIRT1 was significantly reduced compared with cells infected with pSRP or pSRP-shControl (Figure 3, C and D) and that the endogenous SIRT1 was effectively repressed in the shSIRT1-expressing cells (Supplementary Figure 1D.). Hence the ability of SIRT1 to control the growth of BJ cells is observed only in the presence of hTERT expression. Ectopic expression of SIRT1-R reversed the enhanced growth phenotype of BJ cells expressing hTERT and shSIRT1(HS6) (Figure 3D). Hence the results of this genetic rescue experiment indicate that the effect of the SIRT1 shRNA in enhancement of cell growth is specific to SIRT1 and is independent of any off-target effects of the shRNA used.


    Figure 3
    Cooperative effects of SIRT1 knockdown and hTERT expression on cell growth and survival. (A) SIRT1 suppression effects on lifespan of primary BJ fibroblasts. Late-passage BJ cells (≈7 PD before senescence) were infected with either pSRP-shControl or pSRPshSIRT1 (HS6) and pSRP control shRNA vector viruses and cells were subjected to selection in puromycin. (B) Overexpression of wild-type SIRT1 in primary BJ fibroblasts. Same as in A, except for the overexpression constructs (pBabe-Puro-wtSIRT1) and pBabe-Puro control vector were used. (C) Effects of SIRT1 knockdown on growth of BJT (hTERT-IRES-EGFP) fibroblasts. Late-passage BJ fibroblasts were infected with an hTERT containing virus, and the resulting BJT cells were subsequently infected by pSRP-shControl or BJ-pSRPshSIRT1 (HS6) viruses and subjected to a standard replicative lifespan assay. (D) Rescue of the biological effect of shRNA by an shRNA-resistant mutant. BJT cells were infected with pSRP-shControl or BJ-pSRPshSIRT1(HS6) viruses and subsequently infected with the rescue construct PBN-SIRT1-R or PBN control alone. Cells were kept under puromycin and neomycin selection throughout the experiments. BJT cells and their rescue counterparts generated were subjected to a long-term replicative assay as before to asses the ability of SIRT-R to rescue the phenotype of BJT cells expressing the SIRT1 shRNA. (E) BJT cells expressing control of SIRT1 shRNA were subjected to glucose withdrawal on day 0 and cell viability was measured for a week. Experiments were performed in duplicate dishes. Error bars, SEM. (F) Same strains as in E were subjected to glucose withdrawal and at the shown time point (hours after withdrawal), and cell lysates were prepared and subjected to immunoblotting with an anti-SIRT1, anti-phosphor-AMPK-α (Thr-172), total AMPK-α and β-actin antibodies.


    Effect of Glucose Withdrawal on SIRT1-depleted BJT Cells

    When cells are exposed to glucose withdrawal they are known to undergo cell cycle arrest followed by death. When we exposed BJT-pSRP-shControl and BJT-pSRP-shSIRT1(HS6) cells expressing telomerase to nutrient withdrawal by exposing them to media containing no glucose, we found that BJT cells expressing ectopic telomerase with no SIRT1 expression could survive and divide much longer in the initial phases of glucose withdrawal (Figure 3E). Although both control and knockdown cells died at approximately the same time (5th day; Figure 3E). In the control BJT cells, the levels of SIRT1 were gradually increased after glucose depletion and activated AMPK levels gradually increased with time. However, in SIRT1 suppressed BJT cells subjected to glucose withdrawal there was a significant increase early on in total AMPK levels and phosphorylated AMPK protein levels at 4–8 h (AMPK-α Thr 172 phosphorylation).

    Increased Proliferative Capacity of Hematopoietic Stem Cells in Animals Lacking SIRT1

    To extend our findings to a more physiological system, we assayed the effect of SIRT1 deficiency on the establishment of the primitive HSC compartment, by quantitating the total number of HSCs and multipotent progenitors in BM from young (3–9 wk) Sirt1 knockout (Sirt11−/−) and control mice by flow cytometry using rigorous cell surface criteria for isolating HSCs and progenitor cells (Rossi et al., 2005 ) (Supplementary Figure 1). These analyses showed that establishment of neither the HSCs nor multiprogenitor subsets were significantly impacted in the absence of Sirt1 (Figure 4A). Similar results were observed when alternative markers for isolating HSCs were used (Kiel et al., 2005 ; not shown). These results suggest that Sirt1 does not play an important role in establishing HSC homeostasis in young adult mice housed in a stress-free environment.


    Figure 4
    Analysis of the effect of Sirt1 deficiency on HSCs and progenitor frequency and proliferation. (A) Analysis of the affect of Sirt1 deficiency on HSCs and progenitor numbers. Bone marrow was harvested, red blood cells were lysed, and the remaining white cells were stained with fluorophor-conjugated antibodies to markers for HSCs and progenitors (see Materials and Methods for details). Multipotent progenitors and short-term and long-term HSCs are defined as the c-Kit+Sca-1+LinnegFlk2+CD34+ fraction, the c-Kit+Sca-1+Linneg Flk2negCD34+ fraction, and the c-Kit+Sca-1+LinnegFlk2negCD34neg fraction of WBM, respectively. The average total cell number for each type of cell, normalized to body weight, is shown (for each bar, n ≥ 3). Error bars, SD. (B) Quantitative analysis of cell numbers after 1 wk of growth in complete media. BM was stained as described in Materials and Methods, and 100 HSCs were sorted directly into individual wells of a 48-well plate containing complete media. Bars represent average counts from five wells. HSCs are defined as the c-Kit+Sca-1+SLAM(CD150)+LinnegFlk2neg fraction of WBM. (C) Left, graph represents read out over time of Terasaki plates containing single HSCs per well. The HSCs were sorted into Terasaki plates containing serum free X-Vivo media plus IL-3, and plates were monitored daily for the number of wells containing proliferating cells (i.e., more than one cell). Right, graph represents average value of frequency of proliferating HSCs from four Terasaki plates. HSCs are defined as the c-Kit+Sca-1+SLAM(CD150)+LinnegFlk2neg fraction of WBM. For all experiments, mice were 3–9 wk old. p values represent results from Student's t test. (D) Same experiments as in C were performed except that cells were sorted into media containing Steel factor. (E) Analysis of Sirt1 mRNA levels in resting and proliferating HSCs. HSCs (n = 1000) were purified from young adult mice (n = 3), and RNA was either extracted immediately for analysis of resting HSCs (HSC-R) or cells were stimulated to proliferate in media (X-Vivo15 serum-free media [Stem Cell] plus 20 ng/ml Steel factor, 10 ng/ml IL-6, 30 ng/μl IL-3, 2 mM l-Glu, and 50 μM mercaptoethanol) for 5 d for analysis of proliferating HSCs (HSC-S). Both T-cells (CD-3+B220negMac1neg) and B-cells (B220+CD-3negMac1neg) were purified from the bone marrow as a reference. RNA was extracted using Trizol, cDNA was synthesized using Superscript III (Invitrogen), and real-time PCR was performed using primers specific for Hprt (reference) and Sirt1 yielding single amplicons of 100 and 150 bp, respectively. Forty cycles of PCR was performed in triplicate for all samples using an iCycler real-time PCR machine (Bio-Rad). For each cell type, the average level of Sirt1 is shown, relative to Hprt.


    To assess the capacity of young Sirt1-deficient HSCs to proliferate in response to mitogenic stimuli, we purified HSCs from Sirt1−/− and control mice by fluorescence-activated cell sorting, cultured the cells in cytokine-rich media, and then quantitated the total number of progeny cells generated after 7 d (Figure 4B). Strikingly, these experiments revealed that the Sirt1−/− HSCs exhibited a three- to fivefold (≈20,000 cells) increased proliferative capacity compared with Sirt1+/− HSC controls (Figure 4B). To address the capacity of Sirt1-deficient HSCs to proliferate under conditions of nutrient deprivation, we clone sorted HSCs from Sirt1−/− or Sirt1+/− mice into individual wells of Terasaki plates containing cytokine-deprived media and monitored the number of wells in which cell proliferation could be detected (i.e., wells containing two or more cells). As shown in Figure 4, a significantly greater number of Sirt1−/− HSCs were capable of proliferating in media in the presence of single cytokines with either IL-3 (Figure 4C) or SCF (Figure 4D) compared with control HSCs, indicating that Sirt1-deficient HSCs have a greater capacity than controls to proliferate under these restrictive conditions.

    To determine whether Sirt1 expression per se is affected by cell proliferation, we purified HSCs, as described above, and either immediately isolated RNA from resting HSCs (HSC-R), or cultured HSCs in complete media for 4 d before RNA isolation from actively cytokine stimulated HSCs (HSC-S). As shown in Figure 4E, real-time RT-PCR analysis of Sirt1 mRNA levels relative to Hprt reveals a small (about twofold) but significant increase in Sirt1 levels in cytokine stimulated HSCs. Although this result suggests that Sirt1 expression may be cell cycle dependent in HSCs, it is important to note that cytokine-stimulated HSCs undergo extensive differentiation in vitro. Thus it remains to be determined to what extent the regulation of Sirt1 levels has physiologically relevant affects on the proliferation of HSCs in vivo.

    DISCUSSION

    Here we present results showing that SIRT1, the NAD-utilizing deacetylase enzyme is a negative regulator of growth under normal and restrictive conditions in certain cell lineages. Consistent with this notion, efficient inhibition of SIRT1 deacetylase was associated with an increase in telomerase activity that is required for survival and long-term cell growth. Our data indicate that the effect of SIRT1 on telomerase activity is mediated through the catalytic subunit of telomerase, hTERT. On SIRT1 inhibition there is a small increase in hTERT mRNA level and a significant increase in levels of hTERT protein. This increase in mRNA correlated with lack of SIRT1 at proximal regions of hTERT promoter and an increase in total H4 acetylation at the hTERT promoter. Cell lines expressing either endogenous hTERT under its native promoter or primary human diploid fibroblasts expressing ectopic hTERT showed increased levels of hTERT protein and activity upon SIRT1 suppression. We find that the suppression of SIRT1 and its effects on telomerase are independent of how hTERT is expressed (i.e., under native or ectopic viral promoters). Interestingly, we also observed an hTERT doublet in BJT cells in which SIRT1 was expressed suggesting a posttranslational role for SIRT1 in regulation of hTERT protein stability. However, further experimentation is required to investigate if this is caused by increased hTERT acetylation.

    The increased telomerase activity and cell growth phenotype observed could be rescued by a silent mutant SIRT1-R protein that is resistant to repressive effect of shRNA directed to SIRT1, showing that the effect observed was specific. Our results point toward a functional interaction between SIRT1 and hTERT; however, the basis for this genetic interaction is unknown, and it is possible that the effect of SIRT1 on hTERT is not direct and is mediated via other proteins. Furthermore, given the diverse range of SIRT1 targets the effects observed on hTERT maybe one factor that contributes to the observed cellular phenotype.

    Overexpression of SIR2 extends replicative lifespan of single-cell eukaryotes such as S. cerevisae and chronological lifespan of multicellular protostomes such as C. elegans. We reasoned that if the lifespan-inducing functions of the mammalian SIR2 homolog SIRT1 is conserved, this should reflect itself in either survival or replicative lifespan of vertebrate cells with long life spans, such as somatic cells of Homo sapiens.

    When we overexpressed wild-type SIRT1 in mortal normal human diploid BJ fibroblasts, we observed no significant effect on replicative lifespan, consistent with published data (Michishita et al., 2005 ). We also performed the reverse experiments by suppressing SIRT1 to near detection limits in primary BJ fibroblasts, and we still did not observe any effects on replicative life span. Because it has been shown before by us and others that ectopic expression of hTERT and reconstitution of its activity causes life span extension in human cells, we reasoned that inhibition of SIRT1 may have an effect on telomerase-induced extension of lifespan. If primary BJ cells were first infected with an hTERT-expressing virus and sequentially were subjected to SIRT1 inhibition, there was an increased efficiency in cell growth reflected by a decrease in the population doubling time. This effect could be mediated through telomeres or other indirect effects on cell survival. It is however clear from our data that SIRT1 suppression promotes cell growth in the presence of ectopic telomerase activity. Our findings in human cells are consistent with that of others who have shown that murine fibroblasts deficient for Sirt1(Sir2α) have a higher frequency of immortalization (Chua et al., 2005 ). In contrast, others have shown that in different cell types such as endothelial cells SIRT1 suppression has the opposite effect: its loss induces cell cycle arrest (Ota et al., 2007 ). Given the range of substrates currently identified for SIRT1 and their increasing number, it is possible that the contradicting growth-promoting and growth-suppressing properties observed are cell type or species specific.

    Extension of our in vitro results to hematopoiesis under adverse conditions caused by lack of growth factors is consistent with the notion that SIRT1 is a growth suppressor. Although we observed no appreciable difference in HSCs or progenitor frequencies in young Sirt1−/− mice, the in vitro proliferative capacity of Sirt1-deficient HSCs were significantly elevated in both complete media and under cytokine-deprived conditions containing a single growth factor. These results were consistent with that of immortalized human BJT cells lacking SIRT1 expression that showed higher proliferation under normal or glucose-deprived conditions. We found that consistent with the role of activated AMPK in response to low glucose (Salt et al., 1998 ), cells lacking SIRT1 showed an earlier peak in both total levels and activated phospho-AMPK-α protein upon glucose deprivation. Activation of AMPK hence may allow survival in response to an energy shortage. Although this finding suggests that SIRT1 may regulate AMPK, others have found that induction of AMPK by the SIRT1 activator resveratrol is SIRT1 independent (Dasgupta and Milbrandt, 2007 ). Although a useful marker of energy status and survival, AMPK induction observed here maybe due to a complex and indirect effect of SIRT1 on cell survival under ATP-limiting conditions.

    It is possible that under nutrient-restrictive conditions, SIRT1 acts as a growth suppressor to limit division in high-capacity progenitor cells. This limitation may be a physiological response to save on usage of macromolecules required for survival of pre-existing stem cells. Hence, SIRT1 can modulate the division and survival capacity of stem cells in response to nutrient availability. Our results have significant implications for survival of adult stem cells under stress and would be of interest to examine whether SIRT1 has similar effects in other types of stem cells. They also indicate that specific chemical inhibitors of SIRT1 may enhance survival or pluripotency in adult or embryonic human or murine stem cells.

    Evidence suggests that calorie restriction is associated with decreased age-associated tumor incidence (Weindruch, 1992 ). Furthermore, the beneficial biological effects of calorie restriction in increasing lifespan have been well documented. Therefore, it is possible that in human cells, calorie restriction can increase SIRT1 activity, which in turn can suppress immortalizing genes such as telomerase. Therefore increased SIRT1 activity would then suppress tumor incidence and therefore only indirectly leads to extension of lifespan. Hence the effects of induction of molecules such as SIRT1 on longevity of complex multicellular vertebrates may be mediated indirectly via stimulating its tumor suppressor functions and hence reduce death due to cancer. We predict that overexpression of SIRT1 in mice would primarily result in suppression of certain types of tumors. Based on our results and models, SIRT1 overexpression may have no functional effect on the network of human genes promoting somatic cell chronological/replicative survival, leading directly to increased longevity. Current lack of a unifying evolutionary conservation in longevity functions of SIR2 however should not detract from its fundamental roles in cellular survival and growth from yeast to mammals.

    Our findings underscore the importance of nutrient-dependent pathways and propose that SIRT1 is a nutrient-sensitive growth suppressor that may act as an important barrier to retard the growth of certain nutrient-sensitive immortal tumor cells.

    REFERENCES
    • Allsopp R. C., Cheshier S., Weissman I. L. Telomerase activation and rejuvenation of telomere length in stimulated T cells derived from serially transplanted hematopoietic stem cells. J. Exp. Med. 2002;196:1427–1433. [PubMed]
    • Allsopp R. C., Vaziri H., Patterson C., Goldstein S., Younglai E. V., Futcher A. B., Greider C. W., Harley C. B. Telomere length predicts replicative capacity of human fibroblasts. Proc. Natl. Acad. Sci. USA. 1992;89:10114–10118. [PubMed]
    • Baumann P., Cech T. R. Pot1, the putative telomere end-binding protein in fission yeast and humans. Science. 2001;292:1171–1175. [PubMed]
    • Blasco M. A., Lee H. W., Hande M. P., Samper E., Lansdorp P. M., DePinho R. A., Greider C. W. Telomere shortening and tumor formation by mouse cells lacking telomerase RNA. Cell. 1997;91:25–34. [PubMed]
    • Bodnar A. G., Ouellette M., Frolkis M., Holt S. E., Chiu C. P., Morin G. B., Harley C. B., Shay J. W., Lichtsteiner S., Wright W. E. Extension of life-span by introduction of telomerase into normal human cells. Science. 1998;279:349–352. [PubMed]
    • Brunet A., et al. Stress-dependent regulation of FOXO transcription factors by the SIRT1 deacetylase. Science. 2004;303:2011–2015. Epub 2004 Feb 19. [PubMed]
    • Chen W. Y., Wang D. H., Yen R. C., Luo J., Gu W., Baylin S. B. Tumor suppressor HIC1 directly regulates SIRT1 to modulate p53-dependent DNA-damage responses. Cell. 2005;123:437–448. [PubMed]
    • Chiu C. P., Dragowska W., Kim N. W., Vaziri H., Yui J., Thomas T. E., Harley C. B., Lansdorp P. M. Differential expression of telomerase activity in hematopoietic progenitors from adult human bone marrow. Stem Cells. 1996;14:239–248. [PubMed]
    • Chua K. F., et al. Mammalian SIRT1 limits replicative life span in response to chronic genotoxic stress. Cell Metab. 2005;2:67–76. [PubMed]
    • Cohen H. Y., Lavu S., Bitterman K. J., Hekking B., Imahiyerobo T. A., Miller C., Frye R., Ploegh H., Kessler B. M., Sinclair D. A. Acetylation of the C terminus of Ku70 by CBP and PCAF controls Bax-mediated apoptosis. Mol. Cell. 2004a;13:627–638. [PubMed]
    • Cohen H. Y., Miller C., Bitterman K. J., Wall N. R., Hekking B., Kessler B., Howitz K. T., Gorospe M., de Cabo R., Sinclair D. A. Calorie restriction promotes mammalian cell survival by inducing the SIRT1 deacetylase. Science. 2004b;305:390–392. Epub 2004 Jun 17. [PubMed]
    • Colgin L. M., Baran K., Baumann P., Cech T. R., Reddel R. R. Human POT1 facilitates telomere elongation by telomerase. Curr. Biol. 2003;13:942–946. [PubMed]
    • Counter C. M., Avilion A. A., LeFeuvre C. E., Stewart N. G., Greider C. W., Harley C. B., Bacchetti S. Telomere shortening associated with chromosome instability is arrested in immortal cells which express telomerase activity. EMBO J. 1992;11:1921–1929. [PubMed]
    • Dasgupta B., Milbrandt J. Resveratrol stimulates AMP kinase activity in neurons. Proc. Natl. Acad. Sci. USA. 2007;104:7217–7222. Epub 2007 Apr 16. [PubMed]
    • Fabrizio P., Gattazzo C., Battistella L., Wei M., Cheng C., McGrew K., Longo V. D. Sir2 blocks extreme life-span extension. Cell. 2005;123:655–667. [PubMed]
    • Feng J., et al. The RNA component of human telomerase. Science. 1995;269:1236–1241. [PubMed]
    • Greider C. W., Blackburn E. H. Identification of a specific telomere terminal transferase activity in Tetrahymena extracts. Cell. 1985;43:405–413. [PubMed]
    • Haber J., George J. P. A mutation that permits the expression of normally silent copies of mating-type information in Saccharomyces cerevisiae. Genetics. 1979;93:13–35. [PubMed]
    • Harley C. B., Futcher A. B., Greider C. W. Telomeres shorten during ageing of human fibroblasts. Nature. 1990;345:458–460. [PubMed]
    • Harrington L., Zhou W., McPhail T., Oulton R., Yeung D. S., Mar V., Bass M. B., Robinson M. O. Human telomerase contains evolutionarily conserved catalytic and structural subunits. Genes Dev. 1997;11:3109–3115. [PubMed]
    • Hayflick L., Moorhead P. S. The serial cultivation of human diploid cell strains. Exp. Cell Res. 1961;25:585–621.
    • Hopper A. K., Hall B. D. Mating type and sporulation in yeast I. Mutations which alter mating-type control over sporulation. Genetics. 1975;80:41–59. [PubMed]
    • Imai S., Armstrong C. M., Kaeberlein M., Guarente L. Transcriptional silencing and longevity protein Sir2 is an NAD-dependent histone deacetylase. Nature. 2000;403:795–800. [PubMed]
    • Kaeberlein M., Kirkland K. T., Fields S., Kennedy B. K. Sir2-independent life span extension by calorie restriction in yeast. PLoS Biol. 2004;2:E296. Epub 2004 Aug 24. [PubMed]
    • Kaeberlein M., McVey M., Guarente L. The SIR2/3/4 complex and SIR2 alone promote longevity in Saccharomyces cerevisiae by two different mechanisms. Genes Dev. 1999;13:2570–2580. [PubMed]
    • Kaeberlein M., Steffen K. K., Hu D., Dang N., Kerr E. O., Tsuchiya M., Fields S., Kennedy B. K. Comment on “HST2 mediates SIR2-independent life-span extension by calorie restriction” Science. 2006;312:1312. [PubMed]
    • Kiel M. J., Yilmaz O. H., Iwashita T., Terhorst C., Morrison S. J. SLAM family receptors distinguish hematopoietic stem and progenitor cells and reveal endothelial niches for stem cells. Cell. 2005;121:1109–1121. [PubMed]
    • Kim E. J., Kho J. H., Kang M. R., Um S. J. Active regulator of SIRT1 cooperates with SIRT1 and facilitates suppression of p53 activity. Mol. Cell. 2007;28:277–290. [PubMed]
    • Kim N. W., Piatyszek M. A., Prowse K. R., Harley C. B., West M. D., Ho P. L., Coviello G. M., Wright W. E., Weinrich S. L., Shay J. W. Specific association of human telomerase activity with immortal cells and cancer. Science. 1994;266:2011–2015. [PubMed]
    • Kim N. W., Wu F. Advances in quantification and characterization of telomerase activity by the telomeric repeat amplification protocol (TRAP). Nucleic Acids Res. 1997;25:2595–2597. [PubMed]
    • Klar A.J.S., Fogel S., MacLeod K. MAR1—a regulator of HMa and HMalpha loci in Saccharomyces cerevisiae. Genetics. 1979;93:37–50. [PubMed]
    • Lamming D. W., Latorre-Esteves M., Medvedik O., Wong S. N., Tsang F. A., Wang C., Lin S. J., Sinclair D. A. HST2 mediates SIR2-independent life-span extension by calorie restriction. Science. 2005;309:1861–1864. Epub 2005 Jul 28. [PubMed]
    • Langley E., Pearson M., Faretta M., Bauer U. M., Frye R. A., Minucci S., Pelicci P. G., Kouzarides T. Human SIR2 deacetylates p53 and antagonizes PML/p53-induced cellular senescence. EMBO J. 2002;21:2383–2396. [PubMed]
    • Lee H. W., Blasco M. A., Gottlieb G. J., Horner J. W., 2nd, Greider C. W., DePinho R. A. Essential role of mouse telomerase in highly proliferative organs. Nature. 1998;392:569–574. [PubMed]
    • Lin S. J., Defossez P. A., Guarente L. Requirement of NAD and SIR2 for life-span extension by calorie restriction in Saccharomyces cerevisiae. Science. 2000;289:2126–2128. [PubMed]
    • Luo J., Nikolaev A. Y., Imai S., Chen D., Su F., Shiloh A., Guarente L., Gu W. Negative control of p53 by Sir2alpha promotes cell survival under stress. Cell. 2001;107:137–148. [PubMed]
    • McAinsh A. D., Scott-Drew S., Murray J. A., Jackson S. P. DNA damage triggers disruption of telomeric silencing and Mec1p-dependent relocation of Sir3p. Curr. Biol. 1999;9:963–966. [PubMed]
    • Meyerson M., et al. hEST2, the putative human telomerase catalytic subunit gene, is up-regulated in tumor cells and during immortalization. Cell. 1997;90:785–795. [PubMed]
    • Michishita E., Park J. Y., Burneskis J. M., Barrett J. C., Horikawa I. Evolutionarily conserved and nonconserved cellular localizations and functions of human SIRT proteins. Mol. Biol. Cell. 2005;16:4623–4635. Epub 2005 Aug 3. [PubMed]
    • Mills K. D., Sinclair D. A., Guarente L. MEC1-dependent redistribution of the Sir3 silencing protein from telomeres to DNA double-strand breaks. Cell. 1999;97:609–620. [PubMed]
    • Moazed D. Enzymatic activities of Sir2 and chromatin silencing. Curr. Opin. Cell Biol. 2001;13:232–238. [PubMed]
    • Moretti P., Freeman K., Coodly L., Shore D. Evidence that a complex of SIR proteins interacts with the silencer and telomere-binding protein RAP1. Genes Dev. 1994;8:2257–2269. [PubMed]
    • Morin G. B. The human telomere terminal transferase enzyme is a ribonucleoprotein that synthesizes TTAGGG repeats. Cell. 1989;59:521–529. [PubMed]
    • Nakamura T. M., Morin G. B., Chapman K. B., Weinrich S. L., Andrews W. H., Lingner J., Harley C. B., Cech T. R. Telomerase catalytic subunit homologs from fission yeast and human. Science. 1997;277:955–959. [PubMed]
    • Nemoto S., Fergusson M. M., Finkel T. Nutrient availability regulates SIRT1 through a forkhead-dependent pathway. Science. 2004;306:2105–2108. [PubMed]
    • Ota H., Akishita M., Eto M., Iijima K., Kaneki M., Ouchi Y. Sirt1 modulates premature senescence-like phenotype in human endothelial cells. J. Mol. Cell Cardiol. 2007;43:571–579. Epub 2007 Aug 22. [PubMed]
    • Ota H., Tokunaga E., Chang K., Hikasa M., Iijima K., Eto M., Kozaki K., Akishita M., Ouchi Y., Kaneki M. Sirt1 inhibitor, Sirtinol, induces senescence-like growth arrest with attenuated Ras-MAPK signaling in human cancer cells. Oncogene. 2006;25:176–185. [PubMed]
    • Rine J. D., N. S. J., Hicks J. B., Herskowitz I. A suppressor of mating type locus mutations in Saccharomyces cerevisiae: evidence for and identification of cryptic mating type loci. Genetics. 1979;93:877–901. [PubMed]
    • Rossi D. J., Bryder D., Zahn J. M., Ahlenius H., Sonu R., Wagers A. J., Weissman I. L. Cell intrinsic alterations underlie hematopoietic stem cell aging. Proc. Natl. Acad. Sci. USA. 2005;102:9194–9199. Epub 2005 Jun 20. [PubMed]
    • Salt I. P., Johnson G., Ashcroft S. J., Hardie D. G. AMP-activated protein kinase is activated by low glucose in cell lines derived from pancreatic beta cells, and may regulate insulin release. Biochem. J. 1998;335:533–539. [PubMed]
    • Shamblott M. J., Axelman J., Littlefield J. W., Blumenthal P. D., Huggins G. R., Cui Y., Cheng L., Gearhart J. D. Human embryonic germ cell derivatives express a broad range of developmentally distinct markers and proliferate extensively in vitro. Proc. Natl. Acad. Sci. USA. 2001;98:113–118. [PubMed]
    • Smogorzewska A., de Lange T. Regulation of telomerase by telomeric proteins. Annu. Rev. Biochem. 2004;73:177–208. [PubMed]
    • Tanner K. G., Landry J., Sternglanz R., Denu J. M. Silent information regulator 2 family of NAD-dependent histone/protein deacetylases generates a unique product, 1-O-acetyl-ADP-ribose. Proc. Natl. Acad. Sci. USA. 2000;97:14178–14182. [PubMed]
    • Tanny J. C., Moazed D. Coupling of histone deacetylation to NAD breakdown by the yeast silencing protein Sir2. Evidence for acetyl transfer from substrate to an NAD breakdown product. Proc. Natl. Acad. Sci. USA. 2001;98:415–420. [PubMed]
    • Tissenbaum H. A., Guarente L. Increased dosage of a sir-2 gene extends lifespan in Caenorhabditis elegans. Nature. 2001;410:227–230. [PubMed]
    • van Steensel B., de Lange T. Control of telomere length by the human telomeric protein TRF1. Nature. 1997;385:740–743. [PubMed]
    • Vaquero A., Scher M., Lee D., Erdjument-Bromage H., Tempst P., Reinberg D. Human SirT1 interacts with histone H1 and promotes formation of facultative heterochromatin. Mol. Cell. 2004;16:93–105. [PubMed]
    • Vaziri H., Benchimol S. Reconstitution of telomerase activity in normal human cells leads to elongation of telomeres and extended replicative life span. Curr. Biol. 1998;8:279–282. [PubMed]
    • Vaziri H., Dessain S. K., Ng Eaton E., Imai S. I., Frye R. A., Pandita T. K., Guarente L., Weinberg R. A. hSIR2(SIRT1) functions as an NAD-dependent p53 deacetylase. Cell. 2001;107:149–159. [PubMed]
    • Vaziri H., Dragowska W., Allsopp R. C., Thomas T. E., Harley C. B., Lansdorp P. M. Evidence for a mitotic clock in human hematopoietic stem cells: loss of telomeric DNA with age. Proc. Natl. Acad. Sci. USA. 1994;91:9857–9860. [PubMed]
    • Weindruch R. Effect of caloric restriction on age-associated cancers. Exp. Gerontol. 1992;27:575–581. [PubMed]
    • Yeung F., Hoberg J. E., Ramsey C. S., Keller M. D., Jones D. R., Frye R. A., Mayo M. W. Modulation of NF-kappaB-dependent transcription and cell survival by the SIRT1 deacetylase. EMBO J. 2004;23:2369–2380. Epub 2004 May 20. [PubMed]
    • Yilmaz O. H., Kiel M. J., Morrison S. J. SLAM family markers are conserved among hematopoietic stem cells from old and reconstituted mice and markedly increase their purity. Blood. 2006;107:924–930. Epub 2005 Oct 11. [PubMed]

    Wednesday, April 1, 2009

    Resveratrol 'Could Help You Think'

    Men and women did better in mental arithmetic tests after being given resveratrol, the ‘wonder ingredient’ in red wine.

    It is thought that the plant chemical – said to have abilities from burning off junk food to warding off heart disease – increases blood flow to the brain.

    Northumbria University researchers set 24 healthy adults a series of tests before giving them a resveratrol pill or a dummy tablet.

    When they were tested again, those that had taken resveratrol performed better, the British Psychological Society's annual conference will hear today. Other tests confirmed that the drug, which is found in grape skins as well as raspberries, blueberries, cranberries and peanuts, widened blood vessels, boosting the brain's blood supply.

    Researcher Emma Wightman said: ‘It is interesting that a component you come across in many everyday foods can have a positive effect on brain function.’

    Other studies have linked resveratrol with fighting old age, cancer, obesity, diabetes and Alzheimer's disease. It is also claimed that just half a glass of red wine a day can greatly cut the odds of death from heart disease.

    Source: MarieClaire.co.uk

    Followers